Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

VMO1

Product Specifications

Sequence

ATGGAGCGGGGCGCAGGAGCCAAGCTGCTGCCGCTGCTGCTGCTTCTGCGGGCGACTGGTTTCACATGTGCACAGACAGATGGCCGGAACGGCTACACGGCGGTCATCGAAGTGACCAGCGGGGGTCCCTGGGGCGACTGGGCCTGGCCTGAGATGTGTCCCGATGGATTCTTCGCCAGCGGGTTCTCGCTCAAGGTGGAGCCTCCCCAAGGCATTCCTGGCGACGACACTGCACTGAATGGGATCAGGCTGCACTGCGCGCGCGGGAACGTCCTAGGCAATACGCACGTGGTAGAGTCCCAGTCTGGAAGCTGGGGCGAATGGAGTGAGCCGCTGTGGTGTCGCGGCGGCGCCTACCTAGTGGCTTTCTCGCTTCGCGTGGAGGCACCCACGACCCTCGGTGACAACACAGCAGCGAACAACGTGCGCTTCCGCTGTTCAGACGGCGAGGAACTGCAGGGGCCTGGGCTGAGCTGGGGAGACTTTGGAGACTGGAGTGACCATTGCCCCAAGGGCGCGTGCGGCCTGCAGACCAAGATCCAGGGACCTAGAGGCCTCGGCGATGACACTGCGCTGAACGACGCGCGCTTATTCTGCTGCCGCAGTTGA

Length

609

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ISCA1P3 Recombinant Protein (Human)
RP065967 100 µg

ISCA1P3 Recombinant Protein (Human)

Sign In for Pricing
View Details
Cd59 Rabbit Polyclonal Antibody (Biotin)
orb2604656 100 µg

Cd59 Rabbit Polyclonal Antibody (Biotin)

Sign In for Pricing
View Details
Elongator Complex Protein 1 (ELP1, Inhibitor Of Kappa Light Polypeptide Gene Enhancer In B Cells Kinase Complex-associated Protein, IkappaB Kinase Complex-associated Protein, IKK Complex-associated Protein, IKBKAP, IKAP, DKFZP781H1425, DYS, FD, FLJ12497, IKI3, p150, TOT1) (MaxLight 750) discontinued
E2249-79P-ML750 100 µL

Elongator Complex Protein 1 (ELP1, Inhibitor Of Kappa Light Polypeptide Gene Enhancer In B Cells Kinase Complex-associated Protein, IkappaB Kinase Complex-associated Protein, IKK Complex-associated Protein, IKBKAP, IKAP, DKFZP781H1425, DYS, FD, FLJ12497, IKI3, p150, TOT1) (MaxLight 750) discontinued

Sign In for Pricing
View Details
Lentiviral mouse Nelfb shRNA (UAS) - Lentiviral mouse Nelfb shRNA (UAS, GFP) (100)
GTR15126213 1 Vial

Lentiviral mouse Nelfb shRNA (UAS) - Lentiviral mouse Nelfb shRNA (UAS, GFP) (100)

Sign In for Pricing
View Details
2-{4-Hydrazinyl-5H,6H,7H-cyclopenta[D]pyrimidin-2-yl}pyridine
TDC88556-01 50 mg

2-{4-Hydrazinyl-5H,6H,7H-cyclopenta[D]pyrimidin-2-yl}pyridine

Sign In for Pricing
View Details
2-{4-Hydrazinyl-5H,6H,7H-cyclopenta[D]pyrimidin-2-yl}pyridine
TDC88556-02 0.5 g

2-{4-Hydrazinyl-5H,6H,7H-cyclopenta[D]pyrimidin-2-yl}pyridine

Sign In for Pricing
View Details