Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

C21orf67

Product Specifications

Sequence

ATGGCTTGCCTGCGTCACAGCTGTCTCAAGCCCAGGCCCTGGGTGCCAGCCCAAGCCCAAGGACTAGGTCCAGAGCCACACAGCGCCAGGCCACATCCGCCTCACCTGGGACCTTTTGTGGGGTACAGTCTCCGGCCCCACCCAGACCTGCTGAAGGAGAGACCCCATGGCAAGGACTCAGCCACCTGCAGTTTCATAAGCCCCCAGTGGGTTCCTAGGCATGAAGACCACCGGTTAGAGGCTGAACTGGCAGGAACCTGTCTCCAGCCCCTTCTCACCCCAGCCGGGCCCTGCCTCAGAGGCAGCACCCAGGACGTGGCCATGACCCGTGGACTCCACTCAATCCCTCTTCTCCAGGAGCCATGCAAAGTGTCAGCCAGCCAGGCCCCTGGAAGGCAGTCATCACCTCTTAAGGCATTGCGGGTGTCGGTCCTGCAACTGCCAGGTGCAGCACACGACCCATGTCCGGTGTTCGATAGCAGGGAGCCATGA

Length

492

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

General Valine, VAL ELISA Kit
CELI-66014Ge 96 Tests

General Valine, VAL ELISA Kit

Sign In for Pricing
View Details
4-Bromo-3- (difluoromethyl) phenol
PC1009916 1 Each

4-Bromo-3- (difluoromethyl) phenol

Sign In for Pricing
View Details
PHF16 sgRNA CRISPR Lentivector set (Human)
K1640601 3x 1.0 µg

PHF16 sgRNA CRISPR Lentivector set (Human)

Sign In for Pricing
View Details
Actin Related Protein 2/3 Complex Subunit 2 (ARPC2) Antibody
abx030700-01 80 µL

Actin Related Protein 2/3 Complex Subunit 2 (ARPC2) Antibody

Sign In for Pricing
View Details
Actin Related Protein 2/3 Complex Subunit 2 (ARPC2) Antibody
abx030700-02 400 µL

Actin Related Protein 2/3 Complex Subunit 2 (ARPC2) Antibody

Sign In for Pricing
View Details
Goat Polyclonal U2AF1L4 Antibody
NBP1-06996 0.1 mg

Goat Polyclonal U2AF1L4 Antibody

Sign In for Pricing
View Details