Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

LALBA

Product Specifications

Sequence

ATGAGGTTCTTTGTCCCTCTGTTCCTGGTGGGCATCCTGTTCCCTGCCATCCTGGCCAAGCAATTCACAAAATGTGAGCTGTCCCAGCTGCTGAAAGACATAGATGGTTATGGAGGCATCGCTTTGCCTGAATTGATCTGTACCATGTTTCACACCAGTGGTTATGACACACAAGCCATAGTTGAAAACAATGAAAGCACGGAATATGGACTCTTCCAGATCAGTAATAAGCTTTGGTGCAAGAGCAGCCAGGTCCCTCAGTCAAGGAACATCTGTGACATCTCCTGTGACAAGTTCCTGGATGATGACATTACTGATGACATAATGTGTGCCAAGAAGATCCTGGATATTAAAGGAATTGACTACTGGTTGGCCCATAAAGCCCTCTGCACTGAGAAGCTGGAACAGTGGCTTTGTGAGAAGTTGTGA

Length

429

More Discoveries

Explore Other Products

Browse additional items from our catalog

Anti-Zebrafish PROX1a Antibody Picoband® FITC Conjugated
AZF1QAE1-FITC 100 µg/Vial

Anti-Zebrafish PROX1a Antibody Picoband® FITC Conjugated

Sign In for Pricing
View Details
(10Z,13Z,16Z,19Z) -3-Oxodocosatetraenoyl-CoA
HY-CE00031 1 Each

(10Z,13Z,16Z,19Z) -3-Oxodocosatetraenoyl-CoA

Sign In for Pricing
View Details
Recombinant Staphylococcus aureus Potassium-transporting ATPase B chain 1 (kdpB1)
orb2903536-01 20 µg

Recombinant Staphylococcus aureus Potassium-transporting ATPase B chain 1 (kdpB1)

Sign In for Pricing
View Details
Recombinant Staphylococcus aureus Potassium-transporting ATPase B chain 1 (kdpB1)
orb2903536-02 100 µg

Recombinant Staphylococcus aureus Potassium-transporting ATPase B chain 1 (kdpB1)

Sign In for Pricing
View Details
Rabbit Cysteinyl Aspartate Specific Proteinases 3 (Caspase-3) ELISA Kit
MBS9390247 Inquire

Rabbit Cysteinyl Aspartate Specific Proteinases 3 (Caspase-3) ELISA Kit

Sign In for Pricing
View Details
THAP5 (NM_182529) Human Over-expression Lysate
LS168451 100 µg

THAP5 (NM_182529) Human Over-expression Lysate

Sign In for Pricing
View Details