Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CCDC140

Product Specifications

Sequence

ATGGGAGATGAATGTTCAAACCCAGATCTCCTCGCTGAGCCTGGAAGCTCGCCACCGTGGGATCACGGGAACCAGAGGCAAGAGGCTGCGAATGAGTCCAACACCCGCGTTCCTCGAGTTTTAAAAGCACACCTGGGGCCAGAGACTGCACAGCCAACTAAACGGAGTAAACGCAACAGGTGGAGGAGGCAGAGTTGTCAGGGGCCAAGCCCGGCGCGATCTGGCCAGTTCTTGGGGAGCGCGGACCTGGGACTGCAGAGAGGCGTTTTGAAGAGTGCTGCGCGCACCTGCCTCTCGGAGATATCCAACTCCACCCGGGCGTCTCCTGAGAGCGCACAGTCCACAGACCCCGGGAGGGCTGCCCGCCCTAGGACACGTACTCTCCCGACCCCTCACTCTTTCAAAATTGGGGAAGAGGCGGAGGAGATGAAAAAGAAGAAAGAGAGAAAGAGAAGAAAAGAGAGAAAGAAGGAAAGAAATTTTAAAAAATAA

Length

492

More Discoveries

Explore Other Products

Browse additional items from our catalog

Val-Ala-PAB
BA2365-5000 5 g

Val-Ala-PAB

Sign In for Pricing
View Details
Sp2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715323 1.0 µg DNA

Sp2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details
ICOS shRNA Plasmid (h)
sc-42770-SH 20 µg

ICOS shRNA Plasmid (h)

Sign In for Pricing
View Details
STRAP (Serine-Threonine Kinase Receptor-Associated Protein)
493086 100 µL

STRAP (Serine-Threonine Kinase Receptor-Associated Protein)

Sign In for Pricing
View Details
Recombinant Shewanella loihica Protein translocase subunit SecA (secA), partial
MBS1209692 Inquire

Recombinant Shewanella loihica Protein translocase subunit SecA (secA), partial

Sign In for Pricing
View Details
Recombinant Streptomyces coelicolor 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (metE), partial
MBS1445772 Inquire

Recombinant Streptomyces coelicolor 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (metE), partial

Sign In for Pricing
View Details