Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

KRTAP4-1

Product Specifications

Sequence

ATGGTTAACTCTTGTTGTGGCTCTGTCTGCTCTGACCAGGGCTGTGATCAAGGCCTCTGCCAAGAGACCTGCTGCCGCCCCAGCTGCTGCCAGACCACCTGTTGCTGCCCCAGCTGTGTTGTATCCAGCTGCTGCCGCCCATCCTGCTCTCAGACTACCTGCTGCCAGACCACTTGCTGTCGCCCCAGCTGCTGCCGCCCAGTCTGTTGTCAGACCACCTGCCGCCCCAGCTGTGGTGTGTCCAGCTGCTGCCGTCCACTCTGTTGTCAGACCACCTGCCGCCCCAGCTGTGGTGTGTCCAGCTGCTGCCGTCCACTCTGCTGTCAGACCACCTGCTGCCGTACAACTTGCTGCCGCCCCAGCTGCTGTGGATCCTCTTGTTGA

Length

384

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

TAF7L (Transcription initiation Factor TFIID Subunit 7-like, Cancer/Testis antigen 40, CT40, RNA Polymerase II TBP-Associated Factor Subunit Q, TATA box-Binding Protein-Associated Factor 50kD, Transcription initiation Factor TFIID 50kD Subunit, TAF7L, TAF
MBS6459657-01 0.1 mL

TAF7L (Transcription initiation Factor TFIID Subunit 7-like, Cancer/Testis antigen 40, CT40, RNA Polymerase II TBP-Associated Factor Subunit Q, TATA box-Binding Protein-Associated Factor 50kD, Transcription initiation Factor TFIID 50kD Subunit, TAF7L, TAF

Sign In for Pricing
View Details
TAF7L (Transcription initiation Factor TFIID Subunit 7-like, Cancer/Testis antigen 40, CT40, RNA Polymerase II TBP-Associated Factor Subunit Q, TATA box-Binding Protein-Associated Factor 50kD, Transcription initiation Factor TFIID 50kD Subunit, TAF7L, TAF
MBS6459657-02 5x 0.1 mL

TAF7L (Transcription initiation Factor TFIID Subunit 7-like, Cancer/Testis antigen 40, CT40, RNA Polymerase II TBP-Associated Factor Subunit Q, TATA box-Binding Protein-Associated Factor 50kD, Transcription initiation Factor TFIID 50kD Subunit, TAF7L, TAF

Sign In for Pricing
View Details
Plasminogen Rabbit Polyclonal Antibody (PE-Cy7)
orb908481 100 µL

Plasminogen Rabbit Polyclonal Antibody (PE-Cy7)

Sign In for Pricing
View Details
Dissolved Oxygen Meter; Portable DO Meters
E0691 1 Unit

Dissolved Oxygen Meter; Portable DO Meters

Sign In for Pricing
View Details
TRPM2
338280-01 50 µL

TRPM2

Sign In for Pricing
View Details
TRPM2
338280-02 100 µL

TRPM2

Sign In for Pricing
View Details