Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SPANXD

Product Specifications

Sequence

ATGGACAAACAATCCAGTGCCGGCGGGGTGAAGAGGAGCGTCCCCTGTGATTCCAACGAGGCCAACGAGATGATGCCGGAGACCTCGAGTGGGTACTCAGACCCGCAACCTGCTCCGAAAAAACTAAAAACATCTGAGTCCTCGACCATACTAGTGGTTCGCTACAGGAGGAACTTTAAAAGAACATCTCCAGAGGAACTGGTGAATGACCACGCCCGAAAGAACAGAATCAACCCCCTCCAAATGGAGGAGGAGGAATTCATGGAAATAATGGTTGAAATACCTGCAAAGTAG

Length

294

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse GM-CSF Recombinant Protein
PROTP01587-50ug 50 µg

Mouse GM-CSF Recombinant Protein

Sign In for Pricing
View Details
UBF Rabbit Polyclonal Antibody
orb338890-01 30 µL

UBF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
UBF Rabbit Polyclonal Antibody
orb338890-02 50 μL

UBF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
UBF Rabbit Polyclonal Antibody
orb338890-03 100 µL

UBF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
UBF Rabbit Polyclonal Antibody
orb338890-04 200 µL

UBF Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
LentimiRa-hsa-mir-1260b Vector
mh40091 500 ng

LentimiRa-hsa-mir-1260b Vector

Sign In for Pricing
View Details