Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NEDD8

Product Specifications

Sequence

ATGCTAATTAAAGTGAAGACGCTGACCGGAAAGGAGATTGAGATTGACATTGAACCTACAGACAAGGTGGAGCGAATCAAGGAGCGTGTGGAGGAGAAAGAGGGAATCCCCCCACAACAGCAGAGGCTCATCTACAGTGGCAAGCAGATGAATGATGAGAAGACAGCAGCTGATTACAAGATTTTAGGTGGTTCAGTCCTTCACCTGGTGTTGGCTCTGAGAGGAGGAGGTGGTCTTAGGCAGTGA

Length

246

More Discoveries

Explore Other Products

Browse additional items from our catalog

SLC25A23 sgRNA CRISPR Lentivector (Human) (Target 2)
K2178603 1.0 µg DNA

SLC25A23 sgRNA CRISPR Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
NME6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV700527 1.0 µg DNA

NME6 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

Sign In for Pricing
View Details
CCDC62 HDR Plasmid (m)
sc-431597-HDR 20 µg

CCDC62 HDR Plasmid (m)

Sign In for Pricing
View Details
Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) EXPA12 Polyclonal Antibody
MBS9011868 Inquire

Rabbit anti-Arabidopsis thaliana (Mouse-ear cress) EXPA12 Polyclonal Antibody

Sign In for Pricing
View Details
Daoy/STAT5 Reporter (GFP) stable cell line
GTR15423984 1 Vial

Daoy/STAT5 Reporter (GFP) stable cell line

Sign In for Pricing
View Details
Olr587 Protein Vector (Rat) (pPB-C-His)
PV290506 500 ng

Olr587 Protein Vector (Rat) (pPB-C-His)

Sign In for Pricing
View Details