Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SERP1

Product Specifications

Sequence

ATGGTCGCCAAGCAAAGGATCCGTATGGCCAACGAGAAGCACAGCAAGAACATCACCCAGCGCGGCAACGTCGCCAAGACCTCGAGAAATGCCCCCGAAGAGAAGGCGTCTGTAGGACCCTGGTTATTGGCTCTCTTCATTTTTGTTGTCTGTGGTTCTGCAATTTTCCAGATTATTCAAAGTATCAGGATGGGCATGTGA

Length

201

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral human SLC2A4RG shRNA (UAS) - Lentiviral human SLC2A4RG shRNA (UAS) (100)
GTR15105390 1 Vial

Lentiviral human SLC2A4RG shRNA (UAS) - Lentiviral human SLC2A4RG shRNA (UAS) (100)

Sign In for Pricing
View Details
Goat Chordin (CHRD) ELISA Kit
MBS7214385-01 48 Well

Goat Chordin (CHRD) ELISA Kit

Sign In for Pricing
View Details
Goat Chordin (CHRD) ELISA Kit
MBS7214385-02 96 Well

Goat Chordin (CHRD) ELISA Kit

Sign In for Pricing
View Details
Goat Chordin (CHRD) ELISA Kit
MBS7214385-03 5x 96 Well

Goat Chordin (CHRD) ELISA Kit

Sign In for Pricing
View Details
Goat Chordin (CHRD) ELISA Kit
MBS7214385-04 10x 96 Well

Goat Chordin (CHRD) ELISA Kit

Sign In for Pricing
View Details
GM-CSF Protein (N-His, Mouse)
P515538 100 µg

GM-CSF Protein (N-His, Mouse)

Sign In for Pricing
View Details