Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

GABARAP

Product Specifications

Sequence

ATGAAGTTCGTGTACAAAGAAGAGCATCCGTTCGAGAAGCGCCGCTCTGAGGGCGAGAAGATCCGAAAGAAATACCCGGACCGGGTGCCGGTGATAGTAGAAAAGGCTCCCAAAGCTCGGATAGGAGACCTGGACAAAAAGAAATACCTGGTGCCTTCTGATCTCACAGTTGGTCAGTTCTACTTCTTGATCCGGAAGCGAATTCATCTCCGAGCTGAGGATGCCTTGTTTTTCTTTGTCAACAATGTCATTCCACCCACCAGTGCCACAATGGGTCAGCTGTACCAGGAACACCATGAAGAAGACTTCTTTCTCTACATTGCCTACAGTGACGAAAGTGTCTACGGTCTGTGA

Length

354

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CLN8 Human Gene Knockout Kit (CRISPR)
KN402936 1 Kit

CLN8 Human Gene Knockout Kit (CRISPR)

Sign In for Pricing
View Details
Mouse Adamts16 ELISA KIT
ELI-49989m 96 Tests

Mouse Adamts16 ELISA KIT

Sign In for Pricing
View Details
3-Bromo-2- (bromomethyl) pyridine hydrobromide
NCA54057 10 g

3-Bromo-2- (bromomethyl) pyridine hydrobromide

Sign In for Pricing
View Details
AMD1 (NM_001634) Human Tagged ORF Clone
RC221424 10 µg

AMD1 (NM_001634) Human Tagged ORF Clone

Sign In for Pricing
View Details
WDR8 Protein Vector (Human) (pPB-N-His)
PV059794 500 ng

WDR8 Protein Vector (Human) (pPB-N-His)

Sign In for Pricing
View Details
Syntaxin 1A (brain) Rabbit Polyclonal Antibody (PE-Cy5)
orb895391 100 µL

Syntaxin 1A (brain) Rabbit Polyclonal Antibody (PE-Cy5)

Sign In for Pricing
View Details