Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

C14orf142

Product Specifications

Sequence

ATGACATTTAAAAGATGGCTGTTGTATCCTTATTGTCACACTAGGACATTTAAGGAAGACTTATGCTCTAATTTGGAAAAAGCATTTGTGTTGTTCTCCTGGGACAATTTTGTCAAAGAGAAAACTGGTTTTTCTGTTTCTAGCAAAGATAGTAAAGGCTTAGAAATAAAATCTGTTTTCTTGAGAAATAAATTTCAGACCCTGGAAGGAAAATAG

Length

216

More Discoveries

Explore Other Products

Browse additional items from our catalog

TATA binding protein (TBP) (NM_003194) Human Over-expression Lysate
LH19265V 100 µg

TATA binding protein (TBP) (NM_003194) Human Over-expression Lysate

Sign In for Pricing
View Details
XPC (D-10) : m-IgGκ BP-HRP Bundle
sc-521107 1 Kit

XPC (D-10) : m-IgGκ BP-HRP Bundle

Sign In for Pricing
View Details
Taok1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7169102 1.0 µg DNA

Taok1 sgRNA CRISPR Lentivector (Rat) (Target 1)

Sign In for Pricing
View Details
Proteosome (PSM) Human ELISA Kit
95607 96 Tests

Proteosome (PSM) Human ELISA Kit

Sign In for Pricing
View Details
OR6T1 siRNA (Human)
CRJ6422-01 15 nmol

OR6T1 siRNA (Human)

Sign In for Pricing
View Details
OR6T1 siRNA (Human)
CRJ6422-02 30 nmol

OR6T1 siRNA (Human)

Sign In for Pricing
View Details