Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ATP6V1F

Product Specifications

Sequence

ATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGACGAGGACACGGTGACTGGTTTCCTGCTGGGCGGCATAGGGGAGCTTAACAAGAACCGCCATCCCAATTTCCTGGTGGTGGAGAAGGATACAACCATCAATGAGATCGAAGACACTTTCCGGCAATTTCTAAACCGGGATGACATTGGCATCATCCTCATCAACCAGTACATCGCAGAGATGGTGCGGCATGCCCTGGACGCCCACCAGCAGTCCATCCCCGCTGTCCTGGAGATCCCCTCCAAGGAGCACCCATATGACGCCGCCAAGGACTCCATCCTGCGCAGGGCCAGGGGCATGTTCACTGCCGAAGACCTGCGCTAG

Length

360

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cow Calcium And Integrin-Binding Protein 1 (CIB1) ELISA Kit
abx516684 96 Tests

Cow Calcium And Integrin-Binding Protein 1 (CIB1) ELISA Kit

Sign In for Pricing
View Details
ACOT12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
11185066 1.0 µg DNA

ACOT12 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details
Caucasicoside A
MBS5791972 Inquire

Caucasicoside A

Sign In for Pricing
View Details
Fosl2 (NM_008037) Mouse Tagged ORF Clone
MR204779 10 µg

Fosl2 (NM_008037) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
1- (2-Methoxy-4-nitrophenyl) piperazine hydrochloride
OR1050808-01 100 mg

1- (2-Methoxy-4-nitrophenyl) piperazine hydrochloride

Sign In for Pricing
View Details
1- (2-Methoxy-4-nitrophenyl) piperazine hydrochloride
OR1050808-02 250 mg

1- (2-Methoxy-4-nitrophenyl) piperazine hydrochloride

Sign In for Pricing
View Details