Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

C15orf5

Product Specifications

Sequence

ATGCTGAAAAATAGGGAGCTACTTAAAATTTTTGAACAAGCAAGTCACATGATGAAATTAATTGAGGAACATTGTATTTGTGATTGCATATGGATGGAGTGGGAGGACCTAGAGGCAAAGACATTAGATAGGAGACCACCAGAACAAACTAGACGTGAAAGGTGCAGCTGTGGAAATGGAAAGAGATGGGCAAAACCAAAAATCACCACAGAGAAAAAAAATCATCCAGATTTCATGATAGATTGGATGTATTTTGAAACACCTCTCTCCATACAAATGAAATAA

Length

285

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

SB-12L Shaking Water Bath, 115V
BCM1404 1 pcs, 1 UNIT

SB-12L Shaking Water Bath, 115V

Sign In for Pricing
View Details
Ldb1 sgRNA CRISPR Lentivector set (Mouse)
K4897301 3x 1.0 µg

Ldb1 sgRNA CRISPR Lentivector set (Mouse)

Sign In for Pricing
View Details
Tfip11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6357206 1.0 µg DNA

Tfip11 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

Sign In for Pricing
View Details
Canine Bcl2 Like Protein 12 ELISA Kit
MBS7274681-01 48 Well

Canine Bcl2 Like Protein 12 ELISA Kit

Sign In for Pricing
View Details
Canine Bcl2 Like Protein 12 ELISA Kit
MBS7274681-02 96 Well

Canine Bcl2 Like Protein 12 ELISA Kit

Sign In for Pricing
View Details
Canine Bcl2 Like Protein 12 ELISA Kit
MBS7274681-03 5x 96 Well

Canine Bcl2 Like Protein 12 ELISA Kit

Sign In for Pricing
View Details