Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SPINK4

Product Specifications

Sequence

ATGGCCGTCCGCCAGTGGGTAATCGCCCTGGCCTTGGCTGCCCTCCTTGTTGTGGACAGGGAAGTGCCAGTGGCAGCAGGAAAGCTCCCTTTCTCAAGAATGCCCATCTGTGAACACATGGTAGAGTCTCCAACCTGTTCCCAGATGTCCAACCTGGTCTGCGGCACTGATGGGCTCACATATACGAATGAATGCCAGCTCTGCTTGGCCCGGATAAAAACCAAACAGGACATCCAGATCATGAAAGATGGCAAATGCTGA

Length

261

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MAP2K5 293 Cell Lysate
404477 0.1 mg

MAP2K5 293 Cell Lysate

Sign In for Pricing
View Details
Chitosan (~340,000Da)
206996-01 50 g

Chitosan (~340,000Da)

Sign In for Pricing
View Details
Chitosan (~340,000Da)
206996-02 250 g

Chitosan (~340,000Da)

Sign In for Pricing
View Details
Mouse Monoclonal NMT2 Antibody (OTI1G3) - Azide and BSA Free
NBP2-73021 100 µg

Mouse Monoclonal NMT2 Antibody (OTI1G3) - Azide and BSA Free

Sign In for Pricing
View Details
Porcine Chaperone activity of bc1 complex like, mitochondrial (CABC1) ELISA Kit
GTR10355747 96 Well

Porcine Chaperone activity of bc1 complex like, mitochondrial (CABC1) ELISA Kit

Sign In for Pricing
View Details
MCE: Mixed Cellulose Esters
MF013-45-MCE 400 PCS/Box

MCE: Mixed Cellulose Esters

Sign In for Pricing
View Details