Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SPINK4

Product Specifications

Sequence

ATGGCCGTCCGCCAGTGGGTAATCGCCCTGGCCTTGGCTGCCCTCCTTGTTGTGGACAGGGAAGTGCCAGTGGCAGCAGGAAAGCTCCCTTTCTCAAGAATGCCCATCTGTGAACACATGGTAGAGTCTCCAACCTGTTCCCAGATGTCCAACCTGGTCTGCGGCACTGATGGGCTCACATATACGAATGAATGCCAGCTCTGCTTGGCCCGGATAAAAACCAAACAGGACATCCAGATCATGAAAGATGGCAAATGCTGA

Length

261

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ELISA Kit For Collagen alpha-2 (XI) chain
E9532b 96 Tests

ELISA Kit For Collagen alpha-2 (XI) chain

Sign In for Pricing
View Details
ZNF544 sgRNA CRISPR Lentivector (Human) (Target 2)
K2713403 1.0 µg DNA

ZNF544 sgRNA CRISPR Lentivector (Human) (Target 2)

Sign In for Pricing
View Details
Rabbit anti-Saccharomyces cerevisiae (strain 204508/S288c)(Baker's yeast) YHR180W Polyclonal Antibody
MBS7154434 Inquire

Rabbit anti-Saccharomyces cerevisiae (strain 204508/S288c)(Baker's yeast) YHR180W Polyclonal Antibody

Sign In for Pricing
View Details
50% Glycerol Solution
IBS-BG006 250 mL

50% Glycerol Solution

Sign In for Pricing
View Details
RPS20P30 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV783974 1.0 µg DNA

RPS20P30 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

Sign In for Pricing
View Details
FUT4 Mouse Monoclonal Antibody (APC-Cy7)
orb2369181 100 µL

FUT4 Mouse Monoclonal Antibody (APC-Cy7)

Sign In for Pricing
View Details