What is the catalog number for TAC4?

The catalog number for TAC4 is CSB-CL771439HU.

What sizes are available for TAC4?

TAC4 is available in the following size(s): 10 μg Plasmid + 200 μL Glycerol.

TAC4 is currently made to order / not held in immediate stock. Contact us for lead time.

Who manufactures TAC4?

TAC4 is manufactured by Cusabio.

What is the estimated delivery time for TAC4?

Estimated delivery time for TAC4 is approximately 15 business day(s), depending on your location.

TAC4

Product Specifications

Sequence

ATGCTGCCTTGCCTCGCCCTGCTTCTCCTGATGGAGCTGTCCGTGTGCACTGTGGCAGGTGATGGTGGAGAGGAACAGACACTCAGCACTGAAGCAGAGACCTGGGAAGGCGCTGGCCCCAGCATTCAGCTCCAGCTGCAGGAGGTGAAGACGGGCAAGGCAAGCCAGTTCTTTGGGCTGATGGGGAAGCGAGTGGGAGGTGAGTGA

Length

207

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

C07621-10mM/1mL 10 mM/1mL

Nelarabine

Sign In for Pricing

View Details

14244094 4x 500 ng

C1qc-set siRNA/shRNA/RNAi Lentivector (Mouse)

Sign In for Pricing

View Details

orb185333-01 50 μL

MT-ATP6 Rabbit Polyclonal Antibody

Sign In for Pricing

View Details

orb185333-02 100 µL

MT-ATP6 Rabbit Polyclonal Antibody

Sign In for Pricing

View Details

orb185333-03 200 µL

MT-ATP6 Rabbit Polyclonal Antibody

Sign In for Pricing

View Details

TMPY-02531-01 5 µg

S100B Protein, Human, Recombinant (His)

Sign In for Pricing

View Details