Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

PXT1

Product Specifications

Sequence

ATGCAGCTGAGACACATTGGGGACAACATTGATCATAGGATGGTTCGAGAGGATCTTCAACAGGATGGCAGAGATGCACTAGATCATTTTGTCTTCTTTTTCTTTAGAAGAGTTCAGGTGTTGCTGCATTTTTTCTGGAACAACCATTTGCTGTAA

Length

156

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PTGS2 Antibody
MBS7126330-01 0.05 mL

PTGS2 Antibody

Sign In for Pricing
View Details
PTGS2 Antibody
MBS7126330-02 0.1 mL

PTGS2 Antibody

Sign In for Pricing
View Details
PTGS2 Antibody
MBS7126330-03 5x 0.1 mL

PTGS2 Antibody

Sign In for Pricing
View Details
Rods, Glass, Stirring
2067840/C 1 Each

Rods, Glass, Stirring

Sign In for Pricing
View Details
Myeloperoxidase (MPO)
548812 200 µL

Myeloperoxidase (MPO)

Sign In for Pricing
View Details
Phospho-NUDC (Ser326) Rabbit Polyclonal Antibody (APC)
orb1008409 100 µL

Phospho-NUDC (Ser326) Rabbit Polyclonal Antibody (APC)

Sign In for Pricing
View Details