Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

OCLM

Product Specifications

Sequence

ATGGGGATGTATCCACCATTATTGTTAAAGATTTACCTTAGCAGACACATTAGTATACTCTTCTATTTAAAAATCCTTTATAAAAGTGGTATTATATGGCTATCCTGGTATTCTTTCATATTGTTAGTACTTTGA

Length

135

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

BTF3P1 3'UTR GFP Stable Cell Line
TU051950 1.0 mL

BTF3P1 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
SULT2A1 Rabbit Polyclonal Antibody (FITC)
orb9357 100 µL

SULT2A1 Rabbit Polyclonal Antibody (FITC)

Sign In for Pricing
View Details
Human PP-1B Ready-To-Use IHC Kit
orb2984746 50 Tests

Human PP-1B Ready-To-Use IHC Kit

Sign In for Pricing
View Details
Thromboxane synthase Rabbit pAb, IRDye 800CW conjugated
orb2842700 100 µL

Thromboxane synthase Rabbit pAb, IRDye 800CW conjugated

Sign In for Pricing
View Details
SMAD2 (SMAD Family Member 2, JV18, JV18-1, MADH2, MADR2, MGC22139, MGC34440, hMAD-2, hSMAD2) (FITC)
251786-FITC 100 µL

SMAD2 (SMAD Family Member 2, JV18, JV18-1, MADH2, MADR2, MGC22139, MGC34440, hMAD-2, hSMAD2) (FITC)

Sign In for Pricing
View Details
Porcine Cytochromo P450 (Cyt P450) ELISA Kit
MBS2612685-01 48 Well

Porcine Cytochromo P450 (Cyt P450) ELISA Kit

Sign In for Pricing
View Details