Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

OCLM

Product Specifications

Sequence

ATGGGGATGTATCCACCATTATTGTTAAAGATTTACCTTAGCAGACACATTAGTATACTCTTCTATTTAAAAATCCTTTATAAAAGTGGTATTATATGGCTATCCTGGTATTCTTTCATATTGTTAGTACTTTGA

Length

135

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human MYL4 Pre-designed siRNA Set B
SI010123B 1 Each

Human MYL4 Pre-designed siRNA Set B

Sign In for Pricing
View Details
C17orf99 Protein Vector (Human) (pPM-N-D-C-HA)
PV329460 500 ng

C17orf99 Protein Vector (Human) (pPM-N-D-C-HA)

Sign In for Pricing
View Details
AdmiRa-Off-hsa-miR-7152-3p Virus
mh7484 1.0 mL

AdmiRa-Off-hsa-miR-7152-3p Virus

Sign In for Pricing
View Details
RHEB Rabbit pAb
MBS8544277-01 0.1 mL

RHEB Rabbit pAb

Sign In for Pricing
View Details
RHEB Rabbit pAb
MBS8544277-02 0.1 mL (AF405L)

RHEB Rabbit pAb

Sign In for Pricing
View Details
RHEB Rabbit pAb
MBS8544277-03 0.1 mL (AF405S)

RHEB Rabbit pAb

Sign In for Pricing
View Details