Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CDC42SE2

Product Specifications

Sequence

ATGAGTGAATTCTGGTTGTGTTTCAACTGCTGTATTGCAGAACAGCCTCAGCCTAAAAGGCGACGGCGGATTGACAGAAGTATGATTGGAGAGCCCACAAACTTTGTGCATACAGCTCATGTTGGATCAGGAGACCTGTTCAGTGGAATGAATTCAGTTAGCTCCATTCAGAACCAAATGCAGTCCAAGGGAGGTTATGGAGGTGGAATGCCTGCCAATGTCCAGATGCAGCTCGTGGATACGAAGGCGGGATAG

Length

255

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Osteoblast Specific Factor 2 (OSF-2, Periostin, Fasciclin-I like) (MaxLight 750) discontinued
O8057-07-ML750 100 µL

Osteoblast Specific Factor 2 (OSF-2, Periostin, Fasciclin-I like) (MaxLight 750) discontinued

Sign In for Pricing
View Details
CWF19-Like protein 2 (CWF19L2) Human ELISA Kit
C6609 96 Tests

CWF19-Like protein 2 (CWF19L2) Human ELISA Kit

Sign In for Pricing
View Details
KATNB1 antibody
10R-4505 100 µL

KATNB1 antibody

Sign In for Pricing
View Details
HABP2 (Hyaluronan-binding Protein 2, Factor VII-activating Protease, Factor Seven-activating Protease, FSAP, HGFAL, PHBP, Hepatocyte Growth Factor Activator-like Protein, Plasma Hyaluronan-binding Protein) (MaxLight 750)
MBS6233175-01 0.1 mL

HABP2 (Hyaluronan-binding Protein 2, Factor VII-activating Protease, Factor Seven-activating Protease, FSAP, HGFAL, PHBP, Hepatocyte Growth Factor Activator-like Protein, Plasma Hyaluronan-binding Protein) (MaxLight 750)

Sign In for Pricing
View Details
HABP2 (Hyaluronan-binding Protein 2, Factor VII-activating Protease, Factor Seven-activating Protease, FSAP, HGFAL, PHBP, Hepatocyte Growth Factor Activator-like Protein, Plasma Hyaluronan-binding Protein) (MaxLight 750)
MBS6233175-02 5x 0.1 mL

HABP2 (Hyaluronan-binding Protein 2, Factor VII-activating Protease, Factor Seven-activating Protease, FSAP, HGFAL, PHBP, Hepatocyte Growth Factor Activator-like Protein, Plasma Hyaluronan-binding Protein) (MaxLight 750)

Sign In for Pricing
View Details
HBsAg (ayw) Recombinant
orb82328 0.1 mg

HBsAg (ayw) Recombinant

Sign In for Pricing
View Details