Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ABCA11P

Product Specifications

Sequence

ATGGACCCTGAGGGGCAGCAGCAAATGTGGCAGATACTTCAGGCTACCATTAAAAACCAGGAGAGGGGCGCCCTCTTGACCACCCATTACATGTCAGAGGCTAAGTCTCTGTGTGACCGTGTGGCCATCATGGTGTCAGGAACGCTAAGGTGTATTGGTTCCATTCAACAGCTGAAAAGTTTGGTAAAGATTATTTACTAG

Length

201

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Mouse Thrombopoietin, HEK
MBS141550-01 0.002 mg

Recombinant Mouse Thrombopoietin, HEK

Sign In for Pricing
View Details
Recombinant Mouse Thrombopoietin, HEK
MBS141550-02 0.01 mg

Recombinant Mouse Thrombopoietin, HEK

Sign In for Pricing
View Details
Recombinant Mouse Thrombopoietin, HEK
MBS141550-03 1 mg

Recombinant Mouse Thrombopoietin, HEK

Sign In for Pricing
View Details
Recombinant Mouse Thrombopoietin, HEK
MBS141550-04 5x 1 mg

Recombinant Mouse Thrombopoietin, HEK

Sign In for Pricing
View Details
Lentiviral human TEX261 sgRNA gene knockout kit - Lentiviral human TEX261 sgRNA gene knockout kit (100)
GTR15368242 1 Vial

Lentiviral human TEX261 sgRNA gene knockout kit - Lentiviral human TEX261 sgRNA gene knockout kit (100)

Sign In for Pricing
View Details
WRN Antibody
orb380179 100 µL

WRN Antibody

Sign In for Pricing
View Details