Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ABCA11P

Product Specifications

Sequence

ATGGACCCTGAGGGGCAGCAGCAAATGTGGCAGATACTTCAGGCTACCATTAAAAACCAGGAGAGGGGCGCCCTCTTGACCACCCATTACATGTCAGAGGCTAAGTCTCTGTGTGACCGTGTGGCCATCATGGTGTCAGGAACGCTAAGGTGTATTGGTTCCATTCAACAGCTGAAAAGTTTGGTAAAGATTATTTACTAG

Length

201

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

AQP1 Rabbit Polyclonal Antibody (AP)
orb909250 100 µL

AQP1 Rabbit Polyclonal Antibody (AP)

Sign In for Pricing
View Details
Human IL1RAPL2 Pre-designed siRNA Set A
SI007586A 1 Each

Human IL1RAPL2 Pre-designed siRNA Set A

Sign In for Pricing
View Details
CDKN1A, CT (CDKN1A, CAP20, CDKN1, CIP1, MDA6, PIC1, SDI1, WAF1, Cyclin-dependent kinase inhibitor 1, CDK-interacting protein 1, Melanoma differentiation-associated protein 6, p21)
033700 200 µL

CDKN1A, CT (CDKN1A, CAP20, CDKN1, CIP1, MDA6, PIC1, SDI1, WAF1, Cyclin-dependent kinase inhibitor 1, CDK-interacting protein 1, Melanoma differentiation-associated protein 6, p21)

Sign In for Pricing
View Details
Micro tube, PCR, 0,2ml, polypropylene, violet, attached flat cap, 10.000 pieces per CAR
683277 10.000 pieces per CAR

Micro tube, PCR, 0,2ml, polypropylene, violet, attached flat cap, 10.000 pieces per CAR

Sign In for Pricing
View Details
Recombinant Salmonella paratyphi C Probable ubiquinone biosynthesis protein UbiB (ubiB)
MBS7032657-01 0.02 mg

Recombinant Salmonella paratyphi C Probable ubiquinone biosynthesis protein UbiB (ubiB)

Sign In for Pricing
View Details
Recombinant Salmonella paratyphi C Probable ubiquinone biosynthesis protein UbiB (ubiB)
MBS7032657-02 0.1 mg

Recombinant Salmonella paratyphi C Probable ubiquinone biosynthesis protein UbiB (ubiB)

Sign In for Pricing
View Details