Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

C15orf37

Product Specifications

Sequence

ATGCCCAGACCAGCATCCGAAAGCTGGTCTCCTATACAAAGCAGAATCCCTGCCTACAAAGCAGTTTCCCACCTCCGACTCCTCCCCACGGCGAACAGCCCTTCTGGATCCAACCAACCCACCAACCCCAATAGGGCCCAGCACCCAGAGGGTCCACAATCCAGAGAAGGAGCTACAAGCCCTGTACTTGCAAGCCTCGAACCCCCAACTCCAACTGACCTCCCCTCTGCCAGAGCAAGACCACGAGTACCCGCCGAGAGCGGACCTGGCTGGCTACACAAAGCCAGGCGCCCGACCAGAGGGATCCTCCGGGACGTCCTCCGCCACCGGGGCGTCCCCGCCCAGCCCCGCCCGGCGCCCGGCGCTCACCAGCTCTCCTCCCCCTCCTCCTAG

Length

393

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Proser2 (NM_144883) Mouse Tagged ORF Clone
MG207527 10 µg

Proser2 (NM_144883) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
SLC2A7 Adenovirus (Rat)
44105056 1.0 mL

SLC2A7 Adenovirus (Rat)

Sign In for Pricing
View Details
CENPE Rabbit Polyclonal Antibody (BF405)
orb2380658 100 µL

CENPE Rabbit Polyclonal Antibody (BF405)

Sign In for Pricing
View Details
Pyridoxal 5'-Phosphate-d3 (>85%)
TRC-H605892-0.5MG 0.5 mg

Pyridoxal 5'-Phosphate-d3 (>85%)

Sign In for Pricing
View Details
TCP1-set siRNA/shRNA/RNAi Lentivector (Human)
46409091 4x 500 ng

TCP1-set siRNA/shRNA/RNAi Lentivector (Human)

Sign In for Pricing
View Details
KIR2.3 (KCNJ4) mouse monoclonal antibody, clone N25/35
73-069 5 mL

KIR2.3 (KCNJ4) mouse monoclonal antibody, clone N25/35

Sign In for Pricing
View Details