Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

C15orf37

Product Specifications

Sequence

ATGCCCAGACCAGCATCCGAAAGCTGGTCTCCTATACAAAGCAGAATCCCTGCCTACAAAGCAGTTTCCCACCTCCGACTCCTCCCCACGGCGAACAGCCCTTCTGGATCCAACCAACCCACCAACCCCAATAGGGCCCAGCACCCAGAGGGTCCACAATCCAGAGAAGGAGCTACAAGCCCTGTACTTGCAAGCCTCGAACCCCCAACTCCAACTGACCTCCCCTCTGCCAGAGCAAGACCACGAGTACCCGCCGAGAGCGGACCTGGCTGGCTACACAAAGCCAGGCGCCCGACCAGAGGGATCCTCCGGGACGTCCTCCGCCACCGGGGCGTCCCCGCCCAGCCCCGCCCGGCGCCCGGCGCTCACCAGCTCTCCTCCCCCTCCTCCTAG

Length

393

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral mouse Lrrc28 shRNA (UAS) - Lentiviral mouse Lrrc28 shRNA (UAS, GFP) plasmid
GTR15237418 1 Vial

Lentiviral mouse Lrrc28 shRNA (UAS) - Lentiviral mouse Lrrc28 shRNA (UAS, GFP) plasmid

Sign In for Pricing
View Details
FAM24B Lentiviral Activation Particles (h2)
sc-417511-LAC-2 200 µL

FAM24B Lentiviral Activation Particles (h2)

Sign In for Pricing
View Details
BTF3 AAV siRNA Pooled Vector
13531161 1.0 µg

BTF3 AAV siRNA Pooled Vector

Sign In for Pricing
View Details
PHB1 Recombinant Antibody
bsm-61208R-01 20 µL

PHB1 Recombinant Antibody

Sign In for Pricing
View Details
PHB1 Recombinant Antibody
bsm-61208R-02 100 µL

PHB1 Recombinant Antibody

Sign In for Pricing
View Details
Pig Haptoglobin ELISA Kit
HAPT-9 96 Well

Pig Haptoglobin ELISA Kit

Sign In for Pricing
View Details