Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ZNF663

Product Specifications

Sequence

ATGTACACAGGAGAAAAACCTGATGAGTGTAAAGAAAATGAGAAAGCCTTGAAGAAGTTATACCATACTCAAAATGAGAGAACTCATGCAGGAGAGAAAGTCTATGATTGTAAGAAATGTGGGAAATTCTTTCATGAAAAAGCATGCCTTACTCAACATCAGAGAACCCACACAACAGGAAAACCCAGCAAGTGTAATGATAGTGAAAGAGTCTTGAAGGAATCTTGCCTCACTCCCAATCAGAGAATTAAAACAAGATTAAAACAAGAGAGAAAAACTGTAAAGGTAATAAATGTGAGAAACCTTTCTTTGAGAAGTTGA

Length

321

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Melanoma Associated ME20 (ME20M)
TRV-0008859-01 10 µg

Recombinant Melanoma Associated ME20 (ME20M)

Sign In for Pricing
View Details
Recombinant Melanoma Associated ME20 (ME20M)
TRV-0008859-02 50 µg

Recombinant Melanoma Associated ME20 (ME20M)

Sign In for Pricing
View Details
Recombinant Melanoma Associated ME20 (ME20M)
TRV-0008859-03 100 µg

Recombinant Melanoma Associated ME20 (ME20M)

Sign In for Pricing
View Details
Recombinant Melanoma Associated ME20 (ME20M)
TRV-0008859-04 200 µg

Recombinant Melanoma Associated ME20 (ME20M)

Sign In for Pricing
View Details
Recombinant Melanoma Associated ME20 (ME20M)
TRV-0008859-05 500 µg

Recombinant Melanoma Associated ME20 (ME20M)

Sign In for Pricing
View Details
Recombinant Melanoma Associated ME20 (ME20M)
TRV-0008859-06 1 mg

Recombinant Melanoma Associated ME20 (ME20M)

Sign In for Pricing
View Details