Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CCDC88C

Product Specifications

Sequence

ATGGGGGGCGCCGAATGGGAAAGCGAACAGACTGGGGTGAAAACTTTTGGCCCGTTTGGAAGCGGCAGCCAGGACAACCTGACTATGTACATGGATTTAGTGGACGGCATCTTTTTGAACCAAATTATGCTGCAAATAGATCCCAGGCCCACAAATCAACGCATCAATAAGCACGTCAACAATGATGTGAACCTTCGCATTCAGAATTTGACCATCTTGGTGAGAAACATTAAGACCTACTACCAGGATAGACCCTTTTTCCGGTAA

Length

267

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

DZIP1 Recombinant Protein Antigen
NBP2-31587PEP 0.1 mL

DZIP1 Recombinant Protein Antigen

Sign In for Pricing
View Details
Chrne Mouse shRNA Plasmid (Locus ID 11448)
TL500018 1 Kit

Chrne Mouse shRNA Plasmid (Locus ID 11448)

Sign In for Pricing
View Details
TPO Protein (N-His-SUMO, Human)
P509208 100 µg

TPO Protein (N-His-SUMO, Human)

Sign In for Pricing
View Details
AIMP2 Rabbit Polyclonal Antibody (Cy5)
orb904860 100 µL

AIMP2 Rabbit Polyclonal Antibody (Cy5)

Sign In for Pricing
View Details
Serpin A1b, Mouse (HEK293, Fc)
HY-P74555-01 5 µg

Serpin A1b, Mouse (HEK293, Fc)

Sign In for Pricing
View Details
Serpin A1b, Mouse (HEK293, Fc)
HY-P74555-02 10 µg

Serpin A1b, Mouse (HEK293, Fc)

Sign In for Pricing
View Details