Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CCDC88C

Product Specifications

Sequence

ATGGGGGGCGCCGAATGGGAAAGCGAACAGACTGGGGTGAAAACTTTTGGCCCGTTTGGAAGCGGCAGCCAGGACAACCTGACTATGTACATGGATTTAGTGGACGGCATCTTTTTGAACCAAATTATGCTGCAAATAGATCCCAGGCCCACAAATCAACGCATCAATAAGCACGTCAACAATGATGTGAACCTTCGCATTCAGAATTTGACCATCTTGGTGAGAAACATTAAGACCTACTACCAGGATAGACCCTTTTTCCGGTAA

Length

267

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Vmn1r89 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3341702 1.0 µg DNA

Vmn1r89 sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details
Human FN1 / Fibronectin Recombinant Protein
R0037h 1 Each

Human FN1 / Fibronectin Recombinant Protein

Sign In for Pricing
View Details
GlycoBind Binding Buffer - AIA
21510906-2 25 mL

GlycoBind Binding Buffer - AIA

Sign In for Pricing
View Details
NECAP 1 Double Nickase Plasmid (m2)
sc-426646-NIC-2 20 µg

NECAP 1 Double Nickase Plasmid (m2)

Sign In for Pricing
View Details
Histamine H1 Receptor peptide
orb339567-01 1 mg

Histamine H1 Receptor peptide

Sign In for Pricing
View Details
Histamine H1 Receptor peptide
orb339567-02 5 mg

Histamine H1 Receptor peptide

Sign In for Pricing
View Details