Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

WFDC10A

Product Specifications

Sequence

ATGGCACCCCAGACTCTGCTGCCTGTCCTGGTTCTCTGTGTGCTGCTGCTGCAGGCCCAGGGAGGATACCGTGACAAGAAGAGGATGCAGAAAACACAGCTATCCCCAGAAATCAAAGTCTGCCAGCAGCAGCCTAAACTATATCTATGCAAACACTTATGTGAATCTCACCGAGATTGTCAAGCAAATAACATATGCTGTTCTACCTACTGTGGGAATGTTTGCATGAGCATCCTGTGA

Length

240

More Discoveries

Explore Other Products

Browse additional items from our catalog

SBNO1 (A-5) Alexa Fluor® 594
sc-166519 AF594 200 µg/mL

SBNO1 (A-5) Alexa Fluor® 594

Sign In for Pricing
View Details
Recombinant Mouse ZW10 interactor (Zwint)
MBS1418182-01 0.02 mg (E-Coli)

Recombinant Mouse ZW10 interactor (Zwint)

Sign In for Pricing
View Details
Recombinant Mouse ZW10 interactor (Zwint)
MBS1418182-02 0.1 mg (E-Coli)

Recombinant Mouse ZW10 interactor (Zwint)

Sign In for Pricing
View Details
Recombinant Mouse ZW10 interactor (Zwint)
MBS1418182-03 0.02 mg (Yeast)

Recombinant Mouse ZW10 interactor (Zwint)

Sign In for Pricing
View Details
Recombinant Mouse ZW10 interactor (Zwint)
MBS1418182-04 0.1 mg (Yeast)

Recombinant Mouse ZW10 interactor (Zwint)

Sign In for Pricing
View Details
Recombinant Mouse ZW10 interactor (Zwint)
MBS1418182-05 0.02 mg (Baculovirus)

Recombinant Mouse ZW10 interactor (Zwint)

Sign In for Pricing
View Details