What is the catalog number for C17orf89?

The catalog number for C17orf89 is CSB-CL003393HU.

What sizes are available for C17orf89?

C17orf89 is available in the following size(s): 10 μg Plasmid + 200 μL Glycerol.

Is C17orf89 in stock?

C17orf89 is currently made to order / not held in immediate stock. Contact us for lead time.

Who manufactures C17orf89?

C17orf89 is manufactured by Cusabio.

What is the estimated delivery time for C17orf89?

Estimated delivery time for C17orf89 is approximately 15 business day(s), depending on your location.

C17orf89

Product Specifications

Sequence

ATGTCGGCTAACGGAGCGGTGTGGGGCCGCGTGCGAAGCCGCCTCCGCGCCTTCCCCGAGCGGCTGGCCGCCTGCGGGGCCGAGGCCGCGGCGTACGGCAGGTGCGTGCAGGCCTCCACGGCCCCGGGCGGCCGCCTGAGTAAGGACTTCTGCGCGCGGGAGTTCGAGGCCCTGCGGAGCTGCTTCGCCGCTGCGGCCAAGAAGACGCTGGAGGGAGGCTGTTAG

Length

225

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

NBP2-70329FR 0.1 mL

Mouse Monoclonal Carbonic Anhydrase XII/CA12 Antibody (OTI2C6) [DyLight 680]

Sign In for Pricing

View Details

MBS077428-01 48 Well

Porcine Slingshot Homolog 3 ELISA Kit

Sign In for Pricing

View Details

MBS077428-02 96 Well

Porcine Slingshot Homolog 3 ELISA Kit

Sign In for Pricing

View Details

MBS077428-03 5x 96 Well

Porcine Slingshot Homolog 3 ELISA Kit

Sign In for Pricing

View Details

MBS077428-04 10x 96 Well

Porcine Slingshot Homolog 3 ELISA Kit

Sign In for Pricing

View Details

12-4250-20 20 µL

Phospho-c-Cbl (Tyr774) (Clone: R3B8) rabbit mAb

Sign In for Pricing

View Details