Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

COX8C

Product Specifications

Sequence

ATGCCTCTCCTGCGTGGGCGCTGTCCTGCCCGCCGCCACTACCGCCGCTTGGCCCTGCTCGGCCTGCAGCCCGCTCCCCGCTTCGCCCACTCGGGGCCCCCGCGCCAGCGGCCCCTGTCTGCCGCGGAAATGGCTGTTGGACTTGTGGTGTTTTTTACGACCTTCTTAACACCAGCTGCATATGTGCTAGGCAACCTGAAGCAGTTCAGAAGGAATTAG

Length

219

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Anti-Human BRAF/B-Raf (V600E) Antibody (SAA2181)
HB617033-01 50 µg

Anti-Human BRAF/B-Raf (V600E) Antibody (SAA2181)

Sign In for Pricing
View Details
Anti-Human BRAF/B-Raf (V600E) Antibody (SAA2181)
HB617033-02 100 µg

Anti-Human BRAF/B-Raf (V600E) Antibody (SAA2181)

Sign In for Pricing
View Details
Anti-Human BRAF/B-Raf (V600E) Antibody (SAA2181)
HB617033-03 1 mg

Anti-Human BRAF/B-Raf (V600E) Antibody (SAA2181)

Sign In for Pricing
View Details
Human LYR motif containing protein 7 (LYRM7) ELISA Kit
MBS7230131-01 48 Well

Human LYR motif containing protein 7 (LYRM7) ELISA Kit

Sign In for Pricing
View Details
Human LYR motif containing protein 7 (LYRM7) ELISA Kit
MBS7230131-02 96 Well

Human LYR motif containing protein 7 (LYRM7) ELISA Kit

Sign In for Pricing
View Details
Human LYR motif containing protein 7 (LYRM7) ELISA Kit
MBS7230131-03 5x 96 Well

Human LYR motif containing protein 7 (LYRM7) ELISA Kit

Sign In for Pricing
View Details