Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SLIT1

Product Specifications

Sequence

ATGGCGCTGACTCCCGGGTGGGGGTCCTCGGCGGGGCCGGTCCGGCCGGAGCTCTGGCTGCTGCTGTGGGCAGCCGCGTGGCGCCTGGGTGCCTCGGCGTGCCCCGCCCTCTGCACCTGCACCGGAACCACGGTGGACTGCCACGGCACGGGGCTGCAGGCCATTCCCAAGAATATACCTCGGAACACCGAGCGCCTGTGA

Length

201

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Human Protein-c Receptor
MBS146012-01 0.005 mg

Recombinant Human Protein-c Receptor

Sign In for Pricing
View Details
Recombinant Human Protein-c Receptor
MBS146012-02 0.02 mg

Recombinant Human Protein-c Receptor

Sign In for Pricing
View Details
Recombinant Human Protein-c Receptor
MBS146012-03 1 mg

Recombinant Human Protein-c Receptor

Sign In for Pricing
View Details
Recombinant Human Protein-c Receptor
MBS146012-04 5x 1 mg

Recombinant Human Protein-c Receptor

Sign In for Pricing
View Details
Symetine 1mg
A19232-1 1 mg

Symetine 1mg

Sign In for Pricing
View Details
LRATD2 (NM_174911) Human Over-expression Lysate
LH15295V 100 µg

LRATD2 (NM_174911) Human Over-expression Lysate

Sign In for Pricing
View Details