Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CCL7

Product Specifications

Sequence

ATGAAAGCCTCTGCAGCACTTCTGTGTCTGCTGCTCACAGCAGCTGCTTTCAGCCCCCAGGGGCTTGCTCAGCCAGTTGGGATTAATACTTCAACTACCTGCTGCTACAGATTTATCAATAAGAAAATCCCTAAGCAGAGGCTGGAGAGCTACAGAAGGACCACCAGTAGCCACTGTCCCCGGGAAGCTGTAATCTTCAAGACCAAACTGGACAAGGAGATCTGTGCTGACCCCACACAGAAGTGGGTCCAGGACTTTATGAAGCACCTGGACAAGAAAACCCAAACTCCAAAGCTTTGA

Length

300

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Methyl 2-[ (2-chloroacetyl) amino]-4,5-dimethoxybenzoate
OR24407 1 Each

Methyl 2-[ (2-chloroacetyl) amino]-4,5-dimethoxybenzoate

Sign In for Pricing
View Details
CRTC3 Antibody
AF6576-01 100 µL

CRTC3 Antibody

Sign In for Pricing
View Details
CRTC3 Antibody
AF6576-02 200 µL

CRTC3 Antibody

Sign In for Pricing
View Details
SP110 Recombinant Protein Antigen
NBP1-92426PEP 0.1 mL

SP110 Recombinant Protein Antigen

Sign In for Pricing
View Details
2,2-Dimethyl-1-[3- (1-methylethyl) phenyl]-1-propanone
OR1086068-01 250 mg

2,2-Dimethyl-1-[3- (1-methylethyl) phenyl]-1-propanone

Sign In for Pricing
View Details
2,2-Dimethyl-1-[3- (1-methylethyl) phenyl]-1-propanone
OR1086068-02 500 mg

2,2-Dimethyl-1-[3- (1-methylethyl) phenyl]-1-propanone

Sign In for Pricing
View Details