What is the catalog number for MAP1LC3B?

The catalog number for MAP1LC3B is CSB-CL887936HU2.

What sizes are available for MAP1LC3B?

MAP1LC3B is available in the following size(s): 10 μg Plasmid + 200 μL Glycerol.

Is MAP1LC3B in stock?

MAP1LC3B is currently made to order / not held in immediate stock. Contact us for lead time.

Who manufactures MAP1LC3B?

MAP1LC3B is manufactured by Cusabio.

What is the estimated delivery time for MAP1LC3B?

Estimated delivery time for MAP1LC3B is approximately 15 business day(s), depending on your location.

MAP1LC3B

Product Specifications

Sequence

ATGAGTGAGCTCATCAAGATAATTAGAAGGCGCTTACAGCTCAATGCTAATCAGGCCTTCTTCCTGTTGGTGAACGGACACAGCATGGTCAGCGTCTCCACACCAATCTCAGAGGTGTATGAGAGTGAGAAAGATGAAGATGGATTCCTGTACATGGTCTATGCCTCCCAGGAGACGTTCGGGATGAAATTGTCAGTGTAA

Length

201

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

orb2512601 100 µL

Espin/DFNB36 Rabbit Polyclonal Antibody (BF750)

Sign In for Pricing

View Details

RC206528 10 µg

AIM (CD5L) (NM_005894) Human Tagged ORF Clone

Sign In for Pricing

View Details

bsm-61308R-BF750-TR 20 µL

SMARCA4 Recombinant Antibody, AbBy Fluor™ 750 Conjugated

Sign In for Pricing

View Details

sc-92254-SH 20 µg

C14orf180 shRNA Plasmid (h)

Sign In for Pricing

View Details

RD-TRPM7-Ra-48Tests 48 Tests

Rat Transient Receptor Potential Cation Channel Subfamily M, Member 7 (TRPM7) ELISA Kit

Sign In for Pricing

View Details

sc-545662 1 Kit

CRIK (A-6) : m-IgG1 BP-HRP Bundle

Sign In for Pricing

View Details