What is the catalog number for MAP1LC3B?

The catalog number for MAP1LC3B is CSB-CL887936HU2.

What sizes are available for MAP1LC3B?

MAP1LC3B is available in the following size(s): 10 μg Plasmid + 200 μL Glycerol.

Is MAP1LC3B in stock?

MAP1LC3B is currently made to order / not held in immediate stock. Contact us for lead time.

Who manufactures MAP1LC3B?

MAP1LC3B is manufactured by Cusabio.

What is the estimated delivery time for MAP1LC3B?

Estimated delivery time for MAP1LC3B is approximately 15 business day(s), depending on your location.

MAP1LC3B

Product Specifications

Sequence

ATGAGTGAGCTCATCAAGATAATTAGAAGGCGCTTACAGCTCAATGCTAATCAGGCCTTCTTCCTGTTGGTGAACGGACACAGCATGGTCAGCGTCTCCACACCAATCTCAGAGGTGTATGAGAGTGAGAAAGATGAAGATGGATTCCTGTACATGGTCTATGCCTCCCAGGAGACGTTCGGGATGAAATTGTCAGTGTAA

Length

201

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

NBP1-46201IR 0.1 mL

Rabbit Polyclonal TFAP4 Antibody [DyLight 755]

Sign In for Pricing

View Details

sc-281733 100 mg

1- (2-chloropropanoyl) azepane

Sign In for Pricing

View Details

RP029182 100 µg

SLC45A2 Recombinant Protein (Human)

Sign In for Pricing

View Details

NBP2-90525R 0.1 mL

Rabbit Monoclonal Kynureninase Antibody (004) [DyLight 550]

Sign In for Pricing

View Details

TR308233 1 Kit

ZNF184 Human shRNA Plasmid Kit (Locus ID 7738)

Sign In for Pricing

View Details

MBS9393145-01 48 Well

Horse RING Finger Protein 11 (RNF11) ELISA Kit

Sign In for Pricing

View Details