Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

DEFB106A

Product Specifications

Sequence

ATGAGGACTTTCCTCTTTCTCTTTGCCGTGCTCTTCTTTCTGACCCCAGCCAAGAATGCATTTTTTGATGAGAAATGCAACAAACTTAAAGGGACATGCAAGAACAATTGCGGGAAAAACGAAGAACTTATTGCTCTCTGCCAGAAGTCTCTGAAATGCTGTCGGACCATCCAGCCATGTGGGAGCATTATAGATTAA

Length

198

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Panesthia sp. Periviscerokinin-3
MBS1007106-01 0.05 mg (E-Coli)

Recombinant Panesthia sp. Periviscerokinin-3

Sign In for Pricing
View Details
Recombinant Panesthia sp. Periviscerokinin-3
MBS1007106-02 0.2 mg (E-Coli)

Recombinant Panesthia sp. Periviscerokinin-3

Sign In for Pricing
View Details
Recombinant Panesthia sp. Periviscerokinin-3
MBS1007106-03 0.5 mg (E-Coli)

Recombinant Panesthia sp. Periviscerokinin-3

Sign In for Pricing
View Details
Recombinant Panesthia sp. Periviscerokinin-3
MBS1007106-04 0.05 mg (Yeast)

Recombinant Panesthia sp. Periviscerokinin-3

Sign In for Pricing
View Details
Recombinant Panesthia sp. Periviscerokinin-3
MBS1007106-05 0.05 mg (Baculovirus)

Recombinant Panesthia sp. Periviscerokinin-3

Sign In for Pricing
View Details
Recombinant Panesthia sp. Periviscerokinin-3
MBS1007106-06 0.2 mg (Yeast)

Recombinant Panesthia sp. Periviscerokinin-3

Sign In for Pricing
View Details