Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MT4

Product Specifications

Sequence

ATGGACCCCAGGGAATGTGTCTGCATGTCTGGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCACAACCTGCAACTGTAAAACATGTCGGAAGAGCTGCTGTCCCTGCTGCCCCCCGGGCTGTGCCAAATGTGCCCGGGGCTGCATCTGCAAAGGAGGCTCAGACAAGTGCAGCTGCTGCCCATGA

Length

189

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CCNDBP1 (Cyclin-D1-binding Protein 1, Grap2 and Cyclin-D-interacting Protein, Human Homolog of Maid, DIP1, GCIP, HHM) (AP)
MBS6130406-01 0.1 mL

CCNDBP1 (Cyclin-D1-binding Protein 1, Grap2 and Cyclin-D-interacting Protein, Human Homolog of Maid, DIP1, GCIP, HHM) (AP)

Sign In for Pricing
View Details
CCNDBP1 (Cyclin-D1-binding Protein 1, Grap2 and Cyclin-D-interacting Protein, Human Homolog of Maid, DIP1, GCIP, HHM) (AP)
MBS6130406-02 5x 0.1 mL

CCNDBP1 (Cyclin-D1-binding Protein 1, Grap2 and Cyclin-D-interacting Protein, Human Homolog of Maid, DIP1, GCIP, HHM) (AP)

Sign In for Pricing
View Details
CBWD2 Peptide - C-terminal region
orb2006182 100 µg

CBWD2 Peptide - C-terminal region

Sign In for Pricing
View Details
GNF179 1mg
A21042-1 1 mg

GNF179 1mg

Sign In for Pricing
View Details
Cat Legumain ELISA Kit
MBS097797 Inquire

Cat Legumain ELISA Kit

Sign In for Pricing
View Details
HTR3D (HTR3D, 5-hydroxytryptamine Receptor 3D, 5-HT3-D, 5-HT3D, Serotonin Receptor 3D)
524142-01 100 µL

HTR3D (HTR3D, 5-hydroxytryptamine Receptor 3D, 5-HT3-D, 5-HT3D, Serotonin Receptor 3D)

Sign In for Pricing
View Details