Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MT4

Product Specifications

Sequence

ATGGACCCCAGGGAATGTGTCTGCATGTCTGGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCACAACCTGCAACTGTAAAACATGTCGGAAGAGCTGCTGTCCCTGCTGCCCCCCGGGCTGTGCCAAATGTGCCCGGGGCTGCATCTGCAAAGGAGGCTCAGACAAGTGCAGCTGCTGCCCATGA

Length

189

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Complement Receptor Type 1 / CD35 (CR1) CLIA Kit
abx492439-01 96 Tests

Human Complement Receptor Type 1 / CD35 (CR1) CLIA Kit

Sign In for Pricing
View Details
Human Complement Receptor Type 1 / CD35 (CR1) CLIA Kit
abx492439-02 5x 96 Tests

Human Complement Receptor Type 1 / CD35 (CR1) CLIA Kit

Sign In for Pricing
View Details
Human Complement Receptor Type 1 / CD35 (CR1) CLIA Kit
abx492439-03 10x 96 Tests

Human Complement Receptor Type 1 / CD35 (CR1) CLIA Kit

Sign In for Pricing
View Details
BUD23 Rabbit Polyclonal Antibody (FITC)
orb2094585 100 µL

BUD23 Rabbit Polyclonal Antibody (FITC)

Sign In for Pricing
View Details
CRYL1 Antibody - N-terminal region : Biotin (ARP58609_P050-Biotin)
ARP58609_P050-Biotin 100 µL

CRYL1 Antibody - N-terminal region : Biotin (ARP58609_P050-Biotin)

Sign In for Pricing
View Details
Anti-Drebrin/DBN1 Antibody Picoband® (monoclonal, 4F6E7), PE Conjugate
M05530-4-PE 100 µg/Vial

Anti-Drebrin/DBN1 Antibody Picoband® (monoclonal, 4F6E7), PE Conjugate

Sign In for Pricing
View Details