What is the catalog number for MT4?

The catalog number for MT4 is CSB-CL015123HU.

What sizes are available for MT4?

MT4 is available in the following size(s): 10 μg Plasmid + 200 μL Glycerol.

MT4 is currently made to order / not held in immediate stock. Contact us for lead time.

Who manufactures MT4?

MT4 is manufactured by Cusabio.

What is the estimated delivery time for MT4?

Estimated delivery time for MT4 is approximately 15 business day(s), depending on your location.

MT4

Product Specifications

Sequence

ATGGACCCCAGGGAATGTGTCTGCATGTCTGGAGGAATCTGCATGTGTGGAGACAACTGCAAATGCACAACCTGCAACTGTAAAACATGTCGGAAGAGCTGCTGTCCCTGCTGCCCCCCGGGCTGTGCCAAATGTGCCCGGGGCTGCATCTGCAAAGGAGGCTCAGACAAGTGCAGCTGCTGCCCATGA

Length

189

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

abx100703-01 100 µL

Annexin A1 (ANXA1) Antibody

Sign In for Pricing

View Details

abx100703-02 200 µL

Annexin A1 (ANXA1) Antibody

Sign In for Pricing

View Details

abx100703-03 1 mL

Annexin A1 (ANXA1) Antibody

Sign In for Pricing

View Details

12-90363-100 100 µg

Anti-IL6 (vamikibart biosimilar) mAb

Sign In for Pricing

View Details

MC-207 1 mL

MRP2 Monoclonal Antibody [M2II-12]

Sign In for Pricing

View Details

orb1611551 100 µL

Bid Conjugated Antibody

Sign In for Pricing

View Details