Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-3068-3p miRNA Agomir/Antagomir

MicroRNA: rno-miR-3068-3p Accession Number: MIMAT0024846 Mature Sequence GGUGAAUUGCAGUACUCCAACA rno-miR-3068-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-3068-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-3068-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

PLXNC1 Antibody (C-term) Blocking peptide
MBS9220021-01 0.5 mg

PLXNC1 Antibody (C-term) Blocking peptide

Ask
View Details
PLXNC1 Antibody (C-term) Blocking peptide
MBS9220021-02 5x 0.5 mg

PLXNC1 Antibody (C-term) Blocking peptide

Ask
View Details
Clptm1l Rat shRNA Plasmid (Locus ID 316916)
TR706779 1 Kit

Clptm1l Rat shRNA Plasmid (Locus ID 316916)

Ask
View Details
MT-ATP8 Polyclona Antibody
E11-126262 100ul

MT-ATP8 Polyclona Antibody

Ask
View Details
Tmbim4 AAV siRNA Pooled Vector
46813166 1.0 μg

Tmbim4 AAV siRNA Pooled Vector

Ask
View Details
Sheep Anti Mouse Factor IX Polyclonal Antiserum 10ml
ISHAMSFIXASER10ML 10 mL

Sheep Anti Mouse Factor IX Polyclonal Antiserum 10ml

Ask
View Details