Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ rno-miR-3577 miRNA Agomir/Antagomir

MicroRNA: rno-miR-3577 Accession Number: MIMAT0017863 Mature Sequence UCUGUCCCUCUUGGCCCUUAG rno-miR-3577 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about rno-miR-3577 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose rno-miR-3577 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

PCNP sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
36215111 3 x 1.0 µg

PCNP sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Ask
View Details
CHCHD3 HDR Plasmid (m)
sc-425804-HDR 20 µg

CHCHD3 HDR Plasmid (m)

Ask
View Details
Human Bombesin receptor subtype-3,BRS3 ELISA KIT
ELI-33431h 96 Tests

Human Bombesin receptor subtype-3,BRS3 ELISA KIT

Ask
View Details
2-Formylfuran-4-boronic acid
OR3662-01 1 g

2-Formylfuran-4-boronic acid

Ask
View Details
2-Formylfuran-4-boronic acid
OR3662-02 5 g

2-Formylfuran-4-boronic acid

Ask
View Details
2-Formylfuran-4-boronic acid
OR3662-03 25 g

2-Formylfuran-4-boronic acid

Ask
View Details