Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-673-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-673-3p Accession Number: MIMAT0004824 Mature Sequence: UCCGGGGCUGAGUUCUGUGCACC mmu-miR-673-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-673-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-673-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Caspase 9 (Ab-125) Antibody
8B0060-AAT 50 µg

Caspase 9 (Ab-125) Antibody

Ask
View Details
Endothelin-2 (ET-2) (Human, Canine) - I-125 Labeled
T-023-13 10 μCi

Endothelin-2 (ET-2) (Human, Canine) - I-125 Labeled

Ask
View Details
Slc2a3 Rat shRNA Plasmid (Locus ID 25551)
TL709912 1 Kit

Slc2a3 Rat shRNA Plasmid (Locus ID 25551)

Ask
View Details
Atrophin-1 rabbit pAb
ES1734-01 50 µL

Atrophin-1 rabbit pAb

Ask
View Details
Atrophin-1 rabbit pAb
ES1734-02 100 µL

Atrophin-1 rabbit pAb

Ask
View Details
Dld AAV siRNA Pooled Vector
18268164 1.0 μg

Dld AAV siRNA Pooled Vector

Ask
View Details