Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1291 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1291 Accession Number: MIMAT0031397 Mature Sequence: AUGGCUCUUACUGAAGACUAGCAGUU mmu-miR-1291 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1291 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1291 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

LONRF1 ORF Vector (Human) (pORF)
27534011 1.0 µg DNA

LONRF1 ORF Vector (Human) (pORF)

Ask
View Details
Anti-Phospho-DBC1 (Thr454) Antibody
B2024352 100 µg

Anti-Phospho-DBC1 (Thr454) Antibody

Ask
View Details
TPRG1L (NM_182752) Human Recombinant Protein
TP317457 20 µg

TPRG1L (NM_182752) Human Recombinant Protein

Ask
View Details
TLC plates, Kieselguhr F254, Glass Backing, 20x20cm, pack of 25
SI56113 1 Pack

TLC plates, Kieselguhr F254, Glass Backing, 20x20cm, pack of 25

Ask
View Details
Il9r (NM_017021) Rat Tagged Lenti ORF Clone
RR211814L4 10 µg

Il9r (NM_017021) Rat Tagged Lenti ORF Clone

Ask
View Details