Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-654-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-654-5p Accession Number: MIMAT0004897 Mature Sequence: UGGUAAGCUGCAGAACAUGUGU mmu-miR-654-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-654-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-654-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Innovative Grade US Origin Porcine Colon Distal/Anus/Rectum, 36" Fresh  Cleaned
IGPCCLNFT5 1 Each

Innovative Grade US Origin Porcine Colon Distal/Anus/Rectum, 36" Fresh Cleaned

Ask
View Details
Leuco-Malachite Green -NHS Ester
HPT1103-0101 5x 10 mg

Leuco-Malachite Green -NHS Ester

Ask
View Details
Sodium fluoride
12769293-01 100 g

Sodium fluoride

Ask
View Details
Sodium fluoride
12769293-02 500 g

Sodium fluoride

Ask
View Details
AFAP1L1 Peptide - C-terminal region
MBS3242564-01 0.1 mg

AFAP1L1 Peptide - C-terminal region

Ask
View Details
AFAP1L1 Peptide - C-terminal region
MBS3242564-02 5x 0.1 mg

AFAP1L1 Peptide - C-terminal region

Ask
View Details