Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-2137 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-2137 Accession Number: MIMAT0011213 Mature Sequence: GCCGGCGGGAGCCCCAGGGAG mmu-miR-2137 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-2137 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-2137 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Pigeon Acyl Ghrelin ELISA Kit
MBS095144 Inquire

Pigeon Acyl Ghrelin ELISA Kit

Ask
View Details
Human IGF1,  Fc Tag
E24PHA746 50 μg

Human IGF1, Fc Tag

Ask
View Details
Myo19 (NM_025414) Mouse Tagged ORF Clone
MG216211 10 µg

Myo19 (NM_025414) Mouse Tagged ORF Clone

Ask
View Details
Bovine Tissue inhibitors of metalloproteinase 1,TIMP-1 ELISA KIT
JOT-EK0007Bo 96 wells

Bovine Tissue inhibitors of metalloproteinase 1,TIMP-1 ELISA KIT

Ask
View Details
RAI3 (G-6) Alexa Fluor® 680
sc-373825 AF680 200 µg/mL

RAI3 (G-6) Alexa Fluor® 680

Ask
View Details
Rabbit Anti-HDAC8 antibody
SL55094R-01 50 µL

Rabbit Anti-HDAC8 antibody

Ask
View Details