Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-5120 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-5120 Accession Number: MIMAT0020628 Mature Sequence: UUUGGGGCUGUGGUGCCACCAGC mmu-miR-5120 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-5120 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-5120 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Human IL-9 MAb (Clone 623153)
MAB209 100 µg

Human IL-9 MAb (Clone 623153)

Ask
View Details
Anti-CD74 antibody
STJ73084 100 µg

Anti-CD74 antibody

Ask
View Details
MYL5 Antibody
A29241-100UL 100 µL

MYL5 Antibody

Ask
View Details
Mouse Monoclonal Gastrin Antibody (GAST/2633) [Alexa Fluor 594]
NBP3-08685AF594 100 µL

Mouse Monoclonal Gastrin Antibody (GAST/2633) [Alexa Fluor 594]

Ask
View Details
ATOH7 (Protein Atonal Homolog 7, Class A Basic Helix-loop-helix Protein 13, bHLHa13, Helix-loop-helix Protein hATH-5, hATH5, ATH5, BHLHA13) (Biotin)
MBS6370652-01 0.1 mL

ATOH7 (Protein Atonal Homolog 7, Class A Basic Helix-loop-helix Protein 13, bHLHa13, Helix-loop-helix Protein hATH-5, hATH5, ATH5, BHLHA13) (Biotin)

Ask
View Details
ATOH7 (Protein Atonal Homolog 7, Class A Basic Helix-loop-helix Protein 13, bHLHa13, Helix-loop-helix Protein hATH-5, hATH5, ATH5, BHLHA13) (Biotin)
MBS6370652-02 5x 0.1 mL

ATOH7 (Protein Atonal Homolog 7, Class A Basic Helix-loop-helix Protein 13, bHLHa13, Helix-loop-helix Protein hATH-5, hATH5, ATH5, BHLHA13) (Biotin)

Ask
View Details