Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-100-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-100-5p Accession Number: MIMAT0000655 Mature Sequence: AACCCGUAGAUCCGAACUUGUG mmu-miR-100-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-100-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-100-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

PTK6-IN-21b
MBS5783705 Inquire

PTK6-IN-21b

Ask
View Details
CD44V10 (HCAM, Homing Cell Adhesion Molecule, Pgp-1, Phagocytic Glycoprotein-1, Hermes Antigen, Lymphocyte Homing Receptor, ECM-III, HUTCH-1) (HRP)
MBS6468075-01 0.1 mL

CD44V10 (HCAM, Homing Cell Adhesion Molecule, Pgp-1, Phagocytic Glycoprotein-1, Hermes Antigen, Lymphocyte Homing Receptor, ECM-III, HUTCH-1) (HRP)

Ask
View Details
CD44V10 (HCAM, Homing Cell Adhesion Molecule, Pgp-1, Phagocytic Glycoprotein-1, Hermes Antigen, Lymphocyte Homing Receptor, ECM-III, HUTCH-1) (HRP)
MBS6468075-02 5x 0.1 mL

CD44V10 (HCAM, Homing Cell Adhesion Molecule, Pgp-1, Phagocytic Glycoprotein-1, Hermes Antigen, Lymphocyte Homing Receptor, ECM-III, HUTCH-1) (HRP)

Ask
View Details
Atp12a Mouse shRNA Lentiviral Particle (Locus ID 192113)
TL515564V 500 µL Each

Atp12a Mouse shRNA Lentiviral Particle (Locus ID 192113)

Ask
View Details
MYP1 Protein Vector (Human) (pPM-C-HA)
31317021 500 ng

MYP1 Protein Vector (Human) (pPM-C-HA)

Ask
View Details