Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-3960 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-3960 Accession Number: MIMAT0019336 Mature Sequence: GGCGGCGGCGGAGGCGGGGG mmu-miR-3960 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-3960 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-3960 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Chicken anti deoxyribonuclease B antibody (anti DNase B Ab) ELISA Kit
E12A2061-01 48 Well

Chicken anti deoxyribonuclease B antibody (anti DNase B Ab) ELISA Kit

Ask
View Details
Chicken anti deoxyribonuclease B antibody (anti DNase B Ab) ELISA Kit
E12A2061-02 96 Well

Chicken anti deoxyribonuclease B antibody (anti DNase B Ab) ELISA Kit

Ask
View Details
MAFA Antibody (Center) Blocking Peptide
MBS9228211-01 0.5 mg

MAFA Antibody (Center) Blocking Peptide

Ask
View Details
MAFA Antibody (Center) Blocking Peptide
MBS9228211-02 5x 0.5 mg

MAFA Antibody (Center) Blocking Peptide

Ask
View Details
Magic™ Antibody Discovery - Human CD30 / TNFRSF8 (19-379) Membrane Protein, PaRoom Temperatureial, -His tag, [FITC]
MP1103F Each

Magic™ Antibody Discovery - Human CD30 / TNFRSF8 (19-379) Membrane Protein, PaRoom Temperatureial, -His tag, [FITC]

Ask
View Details
KCNJ11 Antibody
A55698-50UG 50 µg

KCNJ11 Antibody

Ask
View Details