Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-7064-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-7064-3p Accession Number: MIMAT0028033 Mature Sequence: CAGGGCCCUUUAUGUCUCUCU mmu-miR-7064-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-7064-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-7064-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Calcium Sensing Receptor (CASR) Rabbit Polyclonal Antibody
TA349050 100 µg

Calcium Sensing Receptor (CASR) Rabbit Polyclonal Antibody

Ask
View Details
Recombinant Human INHA Protein, N-His
YHC13401 100 μg

Recombinant Human INHA Protein, N-His

Ask
View Details
CD86 Polyclonal Antibody
A70462-100 100 µL

CD86 Polyclonal Antibody

Ask
View Details
Protein Z (PROZ) (NM_003891) Human Over-expression Lysate
LS008858 100 µg

Protein Z (PROZ) (NM_003891) Human Over-expression Lysate

Ask
View Details
pEF1α-tdTomato Plasmid
PVT10727 2 µg

pEF1α-tdTomato Plasmid

Ask
View Details
DOM3Z (DXO) (NM_005510) Human Mass Spec Standard
PH305657 10 µg

DOM3Z (DXO) (NM_005510) Human Mass Spec Standard

Ask
View Details