Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1936 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1936 Accession Number: MIMAT0009400 Mature Sequence: UAACUGACCUGCUGUGAACUGGC mmu-miR-1936 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1936 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1936 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

N-1-Z-1,2-diaminoethane · HCl
4028303.0005 5 g

N-1-Z-1,2-diaminoethane · HCl

Ask
View Details
CCNH Antibody
E313475 200ul

CCNH Antibody

Ask
View Details
STYK1 Recombinant Protein Antigen
NBP2-13398PEP 0.1 mL

STYK1 Recombinant Protein Antigen

Ask
View Details
Transthyretin/Prealbumin Overexpression Lysate (Native) - (Dry Ice)
NBL1-17423 0.1 mg

Transthyretin/Prealbumin Overexpression Lysate (Native) - (Dry Ice)

Ask
View Details
BRG1 (PT0157R) PT® Rabbit mAb
YM8571-01 40 µL

BRG1 (PT0157R) PT® Rabbit mAb

Ask
View Details
BRG1 (PT0157R) PT® Rabbit mAb
YM8571-02 100 μL

BRG1 (PT0157R) PT® Rabbit mAb

Ask
View Details