Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-1936 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-1936 Accession Number: MIMAT0009400 Mature Sequence: UAACUGACCUGCUGUGAACUGGC mmu-miR-1936 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-1936 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-1936 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

More Discoveries

Explore Other Products

Browse additional items from our catalog

Chm 3'UTR GFP Stable Cell Line
TU252289 1.0 mL

Chm 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
Rat F9 ELISA Kit
E074111 1 Each

Rat F9 ELISA Kit

Sign In for Pricing
View Details
CLPTM1, ID (CLPTM1, Cleft lip and palate transmembrane protein 1) (PE)
MBS6286898-01 0.2 mL

CLPTM1, ID (CLPTM1, Cleft lip and palate transmembrane protein 1) (PE)

Sign In for Pricing
View Details
CLPTM1, ID (CLPTM1, Cleft lip and palate transmembrane protein 1) (PE)
MBS6286898-02 5x 0.2 mL

CLPTM1, ID (CLPTM1, Cleft lip and palate transmembrane protein 1) (PE)

Sign In for Pricing
View Details
Human PRORP qPCR Primer Pair
QH29301S 200 Tests

Human PRORP qPCR Primer Pair

Sign In for Pricing
View Details
Recombinant Haemophilus influenzae Aspartate--ammonia ligase (asnA)
MBS1102887-01 0.02 mg (E-Coli)

Recombinant Haemophilus influenzae Aspartate--ammonia ligase (asnA)

Sign In for Pricing
View Details