Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-483-5p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-483-5p Accession Number: MIMAT0004782 Mature Sequence: AAGACGGGAGAAGAGAAGGGAG mmu-miR-483-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-483-5p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-483-5p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

CCMFN1 Antibody
PHY2181A 150 μg

CCMFN1 Antibody

Ask
View Details
Heptacosane
MBS392030-01 25 mg

Heptacosane

Ask
View Details
Heptacosane
MBS392030-02 100 mg

Heptacosane

Ask
View Details
Heptacosane
MBS392030-03 5x 100 mg

Heptacosane

Ask
View Details
Paramyxovirus parotitis IgM) Human ELISA Kit
96407 96 Tests

Paramyxovirus parotitis IgM) Human ELISA Kit

Ask
View Details
Eukaryotic Leucine Rich Repeat Containing Protein 15 (LRRC15)
EPQ887Mu61-01 10 µg

Eukaryotic Leucine Rich Repeat Containing Protein 15 (LRRC15)

Ask
View Details