Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6381 miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6381 Accession Number: MIMAT0025127 Mature Sequence: CAGGAUGCUGGUGACAUGAGU mmu-miR-6381 are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6381 in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6381 miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Mouse STI1 AssayLite™ Antibody (RPE Conjugate)
36826-05151 5x 30 µg

Mouse STI1 AssayLite™ Antibody (RPE Conjugate)

Ask
View Details
STOX1 (NM_001130162) Human Tagged Lenti ORF Clone
RC226232L3 10 µg

STOX1 (NM_001130162) Human Tagged Lenti ORF Clone

Ask
View Details
Recombinant Neisseria meningitidis pilin protein Protein, N-His
YXX25501 100 μg

Recombinant Neisseria meningitidis pilin protein Protein, N-His

Ask
View Details
Prunetin
BA7137-5 5mg

Prunetin

Ask
View Details
Mouse INS2 shRNA Plasmid
abx971067-01 150 µg

Mouse INS2 shRNA Plasmid

Ask
View Details
Mouse INS2 shRNA Plasmid
abx971067-02 300 µg

Mouse INS2 shRNA Plasmid

Ask
View Details