Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MIRacle™ mmu-miR-6950-3p miRNA Agomir/Antagomir

MicroRNA: mmu-miR-6950-3p Accession Number: MIMAT0027801 Mature Sequence: CUCUGUCUUGAUCCUCUCCAG mmu-miR-6950-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation, apoptosis, and proliferation, through imperfect pairing with target messenger RNAs (mRNAs) of protein-coding genes and the transcriptional or post-transcriptional regulation of their expression. Click here to browse detailed information about mmu-miR-6950-3p in miRBase. What is MicroRNA Agomir/Antagomir? MicroRNA Agomir is a special-labeled and chemically modified double-stranded small RNA that mimics the endogenous miRNA to regulate the biological function of the target gene. MicroRNA Antagomir is an especially chemically modified miRNA antagonist. It strongly competes with mature miRNAs in the body to prevent the complementary pairing of miRNAs and their target genes, thereby inhibiting miRNAs from functioning. Why choose mmu-miR-6950-3p miRNA Agomir/Antagomir from AcceGen? AcceGen has extended experience in MicroRNA Agomir/Antagomir synthesis services that cover all human, mouse, and rat miRNAs in the current miRBase. Compared to standard miRNA mimics and inhibitors, AcceGen miRNA agomir and antagomir are more resistant to degradation, thus having a lasting effect: minimum for 1 week, up to 5-6 weeks. These products can be used in in vitro or in vivo miRNA functional studies.

Product Specifications

Applications

For research use only

Storage Conditions

Room Temperature

Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

BMPR1A/ALK-3 Protein, Mouse, Recombinant (His & hFc Tag)
E45M53416M4-200 200 ug

BMPR1A/ALK-3 Protein, Mouse, Recombinant (His & hFc Tag)

Ask
View Details
Mouse Timm22 activation kit by CRISPRa
GA205910 1 Kit

Mouse Timm22 activation kit by CRISPRa

Ask
View Details
Ros Lentiviral Activation Particles (h)
sc-402450-LAC 200 µL

Ros Lentiviral Activation Particles (h)

Ask
View Details
Mouse Monoclonal B7-H6 Antibody (875023) [DyLight 405]
MAB71441V 100 µL

Mouse Monoclonal B7-H6 Antibody (875023) [DyLight 405]

Ask
View Details